Optimising passive surveillance of a neglected tropical disease in the era of elimination: A modelling study

Surveillance is a vital part of international packages to remove infectious ailments and avert epidemics of (re-)rising ailments. As the numbers of instances decline, prices of remedy and management diminish however these for surveillance stay excessive even after the ‘final’ case. Reducing surveillance could threat lacking persistent or (re-)rising foci of disease. Here, we use a simulation-based method to find out the minimal quantity of passive surveillance websites required to make sure most protection of a inhabitants at-risk (PAR) of an infectious disease. For this study, we use Gambian human African trypanosomiasis (g-HAT) in north-western Uganda, a neglected tropical disease (NTD) which has been diminished to traditionally low ranges (<1000 instances/12 months globally), for instance.
To quantify journey time to diagnostic services, a proxy for surveillance protection, we produced a excessive spatial-resolution resistance floor and carried out cost-distance analyses. We simulated journey time for the PAR with completely different numbers (1-170) and places (170,000 whole placement combos) of diagnostic services, quantifying the share of the PAR inside 1h and 5h journey of the services, as per in-country targets.
Our simulations point out that a 70% discount (51/170) in diagnostic centres nonetheless exceeded minimal targets of protection even for distant populations, with >95% of a whole PAR of ~3million people dwelling ≤1h from a diagnostic centre, and we show an method to finest place these services, informing a minimal influence cut back. Our outcomes spotlight that surveillance of g-HAT in north-western Uganda could be scaled again with out considerably lowering protection of the PAR. The methodology described can contribute to cost-effective and equable methods for the surveillance of NTDs and different infectious ailments approaching elimination or (re-)emergence.

Achieving fairness in UHC interventions: who’s left behind by neglected tropical disease programmes in Cameroon?

The UN’s Sustainable Development Goals (SDGs) which pledge to depart nobody behind for Universal well being protection (UHC) increase the significance of guaranteeing equitable well being outcomes and healthcare supply. As Neglected Tropical Diseases (NTDs) have an effect on the most deprived and laborious to succeed in populations, they’re thought of a litmus check for Universal well being protection. Here, we assess the challenges of implementing Mass Drug Administrations (MDAs) for schistosomiasis prevention and management, in a context of expanded remedy the place each neighborhood and school-based distribution had been carried out, assessing which teams are missed and creating methods to reinforce fairness.

This is a qualitative study making use of ethnographic observations, in-depth interviews (109) and focus group discussions (6) with key informants and different neighborhood members. Participants included neighborhood drug distributors, academics, well being employees, and implementing companions throughout 4 schistosomiasis endemic areas in Cameroon. Data collected had been analysed thematically.

Programme implementation gaps have created circumstances the place indigenous farmers (initially from the area) and migrating farmers (not initially from the area generally known as ‘strangers’ and ‘farm palms’), girls of reproductive age and school-aged youngsters are constantly missed in MDA efforts in Cameroon. Key implementation challenges that restrict entry to MDA inside this context embody insufficient sensitization campaigns that do not sufficiently construct belief with completely different teams; limits in CDD coaching round being pregnant and reproductive well being;

lack of alignment between distribution and neighborhood availability and the exclusion of current formal and casual governance buildings which have established trusting neighborhood relationships. Through figuring out key populations missed in MDAs inside particular contexts, we spotlight how social inclusion and fairness may very well be elevated inside the Cameroonian context. A primary suggestion is to strengthen belief at the neighborhood degree and work with established partnerships and native governance buildings that may help sustainable options for extra equitable MDA campaigns.

Optimising passive surveillance of a neglected tropical disease in the era of elimination: A modelling study

Chemogenomics and bioinformatics approaches for prioritizing kinases as drug targets for neglected tropical ailments

Neglected tropical ailments (NTDs) are a group of twenty-one ailments labeled by the World Health Organization that prevail in areas with tropical and subtropical local weather and have an effect on a couple of billion folks. There is an pressing have to develop new and safer medication for these ailments. Protein kinases are a potential class of targets for creating new medication towards NTDs, since they play essential position in many organic processes, corresponding to signaling pathways, regulating mobile communication, division, metabolism and demise.
Bioinformatics is a subject that goals to prepare massive quantities of organic information in addition to develop and use instruments for understanding and analyze them in order to supply significant info in a organic method. In mixture with chemogenomics, which analyzes chemical-biological interactions to display ligands towards chosen targets households, these approaches can be utilized to stablish a rational technique for prioritizing new drug targets for NTDs.
Human CD48 antigen(CD48) ELISA kit
E01C1487-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human CD48 antigen(CD48) ELISA kit
E01C1487-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human CD48(CD48 antigen) ELISA Kit
EH4332 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Alias: B-lymphocyte activation marker BLAST-1/BCM1 surface antigen/Leukocyte antigen MEM-102/SLAM family member 2/SLAMF2/Signaling lymphocytic activation molecule 2/BLAST1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Human CD48 antigen, CD48 ELISA KIT
ELI-50290h 96 Tests
EUR 824
Human CD48 antigen(CD48) ELISA kit
CSB-EL004941HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human CD48 antigen (CD48) in samples from serum, plasma, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human CD48 antigen(CD48) ELISA kit
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human CD48 antigen(CD48) in samples from serum, plasma, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Goat CD48 antigen(CD48) ELISA kit
E06C1487-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat CD48 antigen(CD48) ELISA kit
E06C1487-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat CD48 antigen(CD48) ELISA kit
E06C1487-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat CD48 antigen(CD48) ELISA kit
E02C1487-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat CD48 antigen(CD48) ELISA kit
E02C1487-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat CD48 antigen(CD48) ELISA kit
E02C1487-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse CD48 antigen(CD48) ELISA kit
E03C1487-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse CD48 antigen(CD48) ELISA kit
E03C1487-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse CD48 antigen(CD48) ELISA kit
E03C1487-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit CD48 antigen(CD48) ELISA kit
E04C1487-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit CD48 antigen(CD48) ELISA kit
E04C1487-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit CD48 antigen(CD48) ELISA kit
E04C1487-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig CD48 antigen(CD48) ELISA kit
E07C1487-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig CD48 antigen(CD48) ELISA kit
E07C1487-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig CD48 antigen(CD48) ELISA kit
E07C1487-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog CD48 antigen(CD48) ELISA kit
E08C1487-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog CD48 antigen(CD48) ELISA kit
E08C1487-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog CD48 antigen(CD48) ELISA kit
E08C1487-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey CD48 antigen(CD48) ELISA kit
E09C1487-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey CD48 antigen(CD48) ELISA kit
E09C1487-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey CD48 antigen(CD48) ELISA kit
E09C1487-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse CD48 antigen, Cd48 ELISA KIT
ELI-10662m 96 Tests
EUR 865
Mouse CD48 antigen(CD48) ELISA kit
CSB-EL004941MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Mouse CD48 antigen (CD48) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse CD48 antigen(CD48) ELISA kit
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Mouse CD48 antigen(CD48) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Rat CD48 antigen(CD48) ELISA kit
CSB-EL004941RA-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat CD48 antigen (CD48) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Rat CD48 antigen(CD48) ELISA kit
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat CD48 antigen(CD48) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human CD48 Antigen / BLAST1 (CD48) ELISA Kit
abx257911-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.
Guinea pig CD48 antigen(CD48) ELISA kit
E05C1487-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig CD48 antigen(CD48) ELISA kit
E05C1487-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig CD48 antigen(CD48) ELISA kit
E05C1487-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig CD48 antigen(CD48) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Cd48/ Rat Cd48 ELISA Kit
ELI-10387r 96 Tests
EUR 886
CD48 Human Recombinant Protein
PROTP09326 Regular: 10ug
EUR 317
Description: CD48 Human Recombinant produced in Sf9 Insect cells is a single, glycosylated polypeptide chain containing 203 amino acids (27-220a.a.) and having a molecular mass of 23.4kDa (Molecular size on SDS-PAGE will appear at approximately 28-40kDa).;CD48 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.
CD48 Recombinant Protein (Human)
RP006376 100 ug Ask for price
CD48 Recombinant Protein (Human)
RP006379 100 ug Ask for price
CD48 siRNA
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CD48 siRNA
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CD48 siRNA
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CD48 Antibody
ABD2302 100 ug
EUR 438
CD48 Antibody
ABD8214 100 ug
EUR 438
CD48 Antibody
37475-100ul 100ul
EUR 252
CD48 Antibody
45242-100ul 100ul
EUR 252
CD48 Antibody
45242-50ul 50ul
EUR 187
CD48 antibody
10R-6411 100 ug
EUR 192
Description: Mouse monoclonal CD48 antibody
CD48 antibody
70R-16281 50 ul
EUR 435
Description: Rabbit polyclonal CD48 antibody
CD48 Antibody
DF8214 200ul
EUR 304
Description: CD48 Antibody detects endogenous levels of total CD48.
CD48 Antibody
DF2302 200ul
EUR 304
Description: CD48 antibody detects endogenous levels of total CD48.
CD48 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CD48. Recognizes CD48 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
CD48 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CD48. Recognizes CD48 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000
CD48 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CD48. Recognizes CD48 from Human. This antibody is Unconjugated. Tested in the following application: ELISA
CD48 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CD48. Recognizes CD48 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
CD48 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD48. Recognizes CD48 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200
CD48 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD48. Recognizes CD48 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200
YF-PA10802 50 ul
EUR 363
Description: Mouse polyclonal to CD48
YF-PA10803 50 ug
EUR 363
Description: Mouse polyclonal to CD48
YF-PA10804 100 ug
EUR 403
Description: Rabbit polyclonal to CD48
YF-PA23400 50 ul
EUR 334
Description: Mouse polyclonal to CD48
CD48 Recombinant Protein (Rat)
RP193982 100 ug Ask for price
CD48 Recombinant Protein (Mouse)
RP122633 100 ug Ask for price
CD48 cloning plasmid
CSB-CL004941HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 732
  • Sequence: atgtgctccagaggttgggattcgtgtctggctctggaattgctactgctgcctctgtcactcctggtgaccagcattcaaggtcacttggtacatatgaccgtggtctccggcagcaacgtgactctgaacatctctgagagcctgcctgagaactacaaacaactaacctggtt
  • Show more
Description: A cloning plasmid for the CD48 gene.
CD48 cloning plasmid
CSB-CL004941HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 510
  • Sequence: atgtgctccagaggttgggattcgtgtctggctctggaattgctactgctgcctctgtcactcctggtgaccagcattcaaggtcacttggtacatatgaccgtggtctccggcagcaacgtgactctgaacatctctgagagcctgcctgagaactacaaacaactaacctggtt
  • Show more
Description: A cloning plasmid for the CD48 gene.
CD48 Polyclonal Antibody
ES3977-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD48 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
CD48 Polyclonal Antibody
ES3977-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD48 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
CD48 Polyclonal Antibody
ABP52978-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD48
  • Applications tips:
Description: A polyclonal antibody for detection of CD48 from Human. This CD48 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD48
CD48 Polyclonal Antibody
ABP52978-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD48
  • Applications tips:
Description: A polyclonal antibody for detection of CD48 from Human. This CD48 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD48
CD48 Polyclonal Antibody
ABP52978-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD48
  • Applications tips:
Description: A polyclonal antibody for detection of CD48 from Human. This CD48 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD48
Anti-CD48 Antibody
A03281-1 100ug/vial
EUR 294
CD48 Rabbit pAb
A5396-100ul 100 ul
EUR 308
CD48 Rabbit pAb
A5396-200ul 200 ul
EUR 459
CD48 Rabbit pAb
A5396-20ul 20 ul
EUR 183
CD48 Rabbit pAb
A5396-50ul 50 ul
EUR 223
CD48 Polyclonal Antibody
41654-100ul 100ul
EUR 252
CD48 Polyclonal Antibody
41654-50ul 50ul
EUR 187
CD48 Polyclonal Antibody
42109-100ul 100ul
EUR 333
CD48 antibody (FITC)
61R-1092 100 ug
EUR 284
Description: Armenian Hamster monoclonal CD48 antibody (FITC)
CD48 antibody (PE)
61R-1257 100 ug
EUR 354
Description: Armenian Hamster monoclonal CD48 antibody (PE)
CD48 antibody (biotin)
61R-1509 100 ug
EUR 349
Description: Armenian Hamster monoclonal CD48 antibody (biotin)
CD48 antibody (allophycocyanin)
61R-1737 100 ug
EUR 521
Description: Armenian Hamster monoclonal CD48 antibody (allophycocyanin)
CD48 Blocking Peptide
DF8214-BP 1mg
EUR 195
CD48 Blocking Peptide
DF2302-BP 1mg
EUR 195
Anti-CD48 antibody
STJ96612 200 µl
EUR 197
Description: Rabbit polyclonal to CD48.
Anti-CD48 antibody
STJ11100911 100 µl
EUR 277
Description: This gene encodes a member of the CD2 subfamily of immunoglobulin-like receptors which includes SLAM (signaling lymphocyte activation molecules) proteins. The encoded protein is found on the surface of lymphocytes and other immune cells, dendritic cells and endothelial cells, and participates in activation and differentiation pathways in these cells. The encoded protein does not have a transmembrane domain, however, but is held at the cell surface by a GPI anchor via a C-terminal domain which maybe cleaved to yield a soluble form of the receptor. Multiple transcript variants encoding different isoforms have been found for this gene.
Anti-CD48 antibody
STJ16100049 100 µg
EUR 406
EF007475 96 Tests
EUR 689
Human CD48 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human CD48 ELISA Kit
DEIA237 5 plates
EUR 1368
Description: The Human CD48 ELISA Kit is for the quantitative determination of human CD48.
Recombinant Human CD48/SLAMF2/BCM1 Protein
RP00107 20 μg
EUR 183
Recombinant Human CD48/SLAMF2/BCM1 Protein
RP00266 20 μg
EUR 202
Human CellExp? CD48 / BCM1 / SLAMF2, human recombinant
EUR 245
Human CellExp? CD48 / BCM1 / SLAMF2, human recombinant
EUR 697
CD48(156-4H9) Antibody
BNC610307-100 100uL
EUR 199
Description: Primary antibody against CD48(156-4H9), CF660R conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNC610307-500 500uL
EUR 544
Description: Primary antibody against CD48(156-4H9), CF660R conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNC611057-100 100uL
EUR 199
Description: Primary antibody against CD48(5-4.8), CF660R conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNC611057-500 500uL
EUR 544
Description: Primary antibody against CD48(5-4.8), CF660R conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNC680307-100 100uL
EUR 199
Description: Primary antibody against CD48(156-4H9), CF568 conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNC680307-500 500uL
EUR 544
Description: Primary antibody against CD48(156-4H9), CF568 conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNC401057-100 100uL
EUR 199
Description: Primary antibody against CD48(5-4.8), CF640R conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNC401057-500 500uL
EUR 544
Description: Primary antibody against CD48(5-4.8), CF640R conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNC430307-100 100uL
EUR 199
Description: Primary antibody against CD48(156-4H9), CF543 conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNC430307-500 500uL
EUR 544
Description: Primary antibody against CD48(156-4H9), CF543 conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNC431057-100 100uL
EUR 199
Description: Primary antibody against CD48(5-4.8), CF543 conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNC431057-500 500uL
EUR 544
Description: Primary antibody against CD48(5-4.8), CF543 conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNC471057-100 100uL
EUR 199
Description: Primary antibody against CD48(5-4.8), CF647 conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNC471057-500 500uL
EUR 544
Description: Primary antibody against CD48(5-4.8), CF647 conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNC550307-100 100uL
EUR 199
Description: Primary antibody against CD48(156-4H9), CF555 conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNC550307-500 500uL
EUR 544
Description: Primary antibody against CD48(156-4H9), CF555 conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNC551057-100 100uL
EUR 199
Description: Primary antibody against CD48(5-4.8), CF555 conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNC551057-500 500uL
EUR 544
Description: Primary antibody against CD48(5-4.8), CF555 conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNC040307-100 100uL
EUR 199
Description: Primary antibody against CD48(156-4H9), CF405S conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNC040307-500 500uL
EUR 544
Description: Primary antibody against CD48(156-4H9), CF405S conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNC050307-100 100uL
EUR 199
Description: Primary antibody against CD48(156-4H9), CF405M conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNC050307-500 500uL
EUR 544
Description: Primary antibody against CD48(156-4H9), CF405M conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNC051057-100 100uL
EUR 199
Description: Primary antibody against CD48(5-4.8), CF405M conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNC051057-500 500uL
EUR 544
Description: Primary antibody against CD48(5-4.8), CF405M conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNC400307-100 100uL
EUR 199
Description: Primary antibody against CD48(156-4H9), CF640R conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNC400307-500 500uL
EUR 544
Description: Primary antibody against CD48(156-4H9), CF640R conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNC041057-100 100uL
EUR 199
Description: Primary antibody against CD48(5-4.8), CF405S conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNC041057-500 500uL
EUR 544
Description: Primary antibody against CD48(5-4.8), CF405S conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNC470307-100 100uL
EUR 199
Description: Primary antibody against CD48(156-4H9), CF647 conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNC470307-500 500uL
EUR 544
Description: Primary antibody against CD48(156-4H9), CF647 conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNUB1057-100 100uL
EUR 209
Description: Primary antibody against CD48(5-4.8), Concentration: 0.2mg/mL
CD48(5-4.8) Antibody
BNUB1057-500 500uL
EUR 458
Description: Primary antibody against CD48(5-4.8), Concentration: 0.2mg/mL
CD48(156-4H9) Antibody
BNUM0307-50 50uL
EUR 395
Description: Primary antibody against CD48(156-4H9), 1mg/mL
CD48(5-4.8) Antibody
BNUM1057-50 50uL
EUR 395
Description: Primary antibody against CD48(5-4.8), 1mg/mL
Rat CD48 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
CD48(5-4.8) Antibody
BNC681057-100 100uL
EUR 199
Description: Primary antibody against CD48(5-4.8), CF568 conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNC681057-500 500uL
EUR 544
Description: Primary antibody against CD48(5-4.8), CF568 conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNC700307-100 100uL
EUR 199
Description: Primary antibody against CD48(156-4H9), CF770 conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNC700307-500 500uL
EUR 544
Description: Primary antibody against CD48(156-4H9), CF770 conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNC701057-100 100uL
EUR 199
Description: Primary antibody against CD48(5-4.8), CF770 conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNC701057-500 500uL
EUR 544
Description: Primary antibody against CD48(5-4.8), CF770 conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNC940307-100 100uL
EUR 199
Description: Primary antibody against CD48(156-4H9), CF594 conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNC940307-500 500uL
EUR 544
Description: Primary antibody against CD48(156-4H9), CF594 conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNC941057-100 100uL
EUR 199
Description: Primary antibody against CD48(5-4.8), CF594 conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNC941057-500 500uL
EUR 544
Description: Primary antibody against CD48(5-4.8), CF594 conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNCH0307-100 100uL
EUR 199
Description: Primary antibody against CD48(156-4H9), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNCH0307-500 500uL
EUR 544
Description: Primary antibody against CD48(156-4H9), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNCH1057-100 100uL
EUR 199
Description: Primary antibody against CD48(5-4.8), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNCH1057-500 500uL
EUR 544
Description: Primary antibody against CD48(5-4.8), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNC800307-100 100uL
EUR 199
Description: Primary antibody against CD48(156-4H9), CF680 conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNC800307-500 500uL
EUR 544
Description: Primary antibody against CD48(156-4H9), CF680 conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNC801057-100 100uL
EUR 199
Description: Primary antibody against CD48(5-4.8), CF680 conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNC801057-500 500uL
EUR 544
Description: Primary antibody against CD48(5-4.8), CF680 conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNC810307-100 100uL
EUR 199
Description: Primary antibody against CD48(156-4H9), CF680R conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNC810307-500 500uL
EUR 544
Description: Primary antibody against CD48(156-4H9), CF680R conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNCP0307-250 250uL
EUR 383
Description: Primary antibody against CD48(156-4H9), PerCP conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNCP1057-250 250uL
EUR 383
Description: Primary antibody against CD48(5-4.8), PerCP conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNCR0307-250 250uL
EUR 383
Description: Primary antibody against CD48(156-4H9), RPE conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNCR1057-250 250uL
EUR 383
Description: Primary antibody against CD48(5-4.8), RPE conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNCA0307-250 250uL
EUR 383
Description: Primary antibody against CD48(156-4H9), APC conjugate, Concentration: 0.1mg/mL
CD48(5-4.8) Antibody
BNCA1057-250 250uL
EUR 383
Description: Primary antibody against CD48(5-4.8), APC conjugate, Concentration: 0.1mg/mL
CD48(156-4H9) Antibody
BNCAP0307-100 100uL
EUR 199
Description: Primary antibody against CD48(156-4H9), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
Here, we describe how bioinformatics and chemogenomics instruments will help to determine protein kinases and their potential inhibitors for the growth of new medication for NTDs. We current a evaluate of bioinformatics instruments and methods that can be utilized to outline an organisms kinome for drug prioritization, drug and goal repurposing, multi-quinase inhibition approachs and selectivity profiling. We additionally current some profitable examples of the software of such approaches in latest case research.