The impact of Neglected Tropical Diseases (NTDs) on health and wellbeing in sub-Saharan Africa (SSA): A case study of Kenya

Neglected Tropical Diseases (NTDs) stay endemic to many areas of sub-Saharan Africa (SSA) left behind by socioeconomic progress. As such, these illnesses are markers of excessive poverty and inequity which might be propagated by the political, financial, social, and cultural methods that have an effect on health and wellbeing. As international locations embrace and work in the direction of reaching the Sustainable Development Goals (SDGs), the wants of such susceptible populations have to be addressed in native and world arenas. The analysis makes use of major qualitative information collected from 5 NTD endemic counties of Kenya: interviews key informants (n = 21) concerned in NTD implementation applications and focus teams (n = 5) of affected people.

Informed by theories of political ecology of health, the analysis focuses on post-devolution Kenya and identifies the political, financial, social, and cultural elements that propagate NTDs and their results on health and wellbeing. Our findings point out that structural elements akin to competing political pursuits, health employee strikes, insufficient budgetary allocations, financial alternative, marginalization, illiteracy, entrenched cultural norms and practices, poor entry to water, sanitation and housing, all serve to propagate NTD transmission and subsequently have an effect on the health and wellbeing of populations.

As such, we advocate that post-devolution Kenya ensures native political, financial and socio-cultural constructions are equitable, delicate and attentive to the wants of all individuals. We additionally suggest poverty alleviation via capability constructing and empowerment as a way of tackling NTDs for sustained financial alternative and productiveness on the native and nationwide degree. Only three instances of leprosy have been confirmed. The 185 (16.7%) suspected instances of yaws have been all destructive with the speedy check. The majority of instances have been different pores and skin situations, together with fungal infections, eczema and traumatic lesions.

The historical past of the uncared for tropical illness motion is seen via the lens of authors who labored over the last four many years in totally different roles and in totally different settings, from Western-based laboratories to medical roles in endemic international locations and in essential coverage roles in the World Health Organization (WHO). The authors search to establish key gamers from the introduction of the phrase ‘uncared for’ by the late Kenneth Warren in his Rockefeller Foundation-supported Great Neglected Diseases of Mankind motion via to the newer developments after the London Declaration of 2012.

The position of the varied actors-endemic international locations, main pharmaceutical corporations, the WHO, non-government growth organizations, bilateral donors and academia-are mentioned. The essential occasions and selections are highlighted that had been important enabling elements in making a viable and profitable motion and with a resultant large world public health and antipoverty impact. The significance of advocacy is emphasised in creating the momentum to determine a globally acknowledged public health ‘model’ as a goal in the United Nations Sustainable Development Goals.

The impact of COVID-19 pandemic on AIDS-related mycoses and fungal uncared fortropicalillnesses: Why ought to we fear?

The World Health Organization (WHO) considers mycetoma, chromoblastomycosis, and paracoccidioidomycosis to be fungal uncared for tropical illnesses (FNTDs). Depending on climatic, cultural, and financial contexts, these illnesses have an identical geographical distribution as many different illnesses, significantly tuberculosis (TB) and malaria, however are sometimes much less focused by the nationwide and many worldwide healthcare methods. Another subgroup of fungal infections, akin to candidiasis, cryptococcosis, pneumocystosis, histoplasmosis, and to a lesser extent, aspergillosis, are often known as AIDS-related mycoses. Although antiretroviral remedy (ART) has been capable of lower the mortality price of these illnesses, significantly cryptococcosis, the disproportionately low distribution of funds to their analysis and therapy stays an impediment in saving and enhancing the lives of sufferers affected.

A new wave of viral illnesses dubbed the Coronavirus Disease 2019 (COVID-19) hit the world on the finish of 2019. Due to progressive signs and excessive mortality charges of COVID-19 in comparison with fungal infections, significantly the FNTDs, funding is presently allotted predominantly for diagnostic and therapeutic analysis on COVID-19. As a outcome, advances in FNTDs and AIDS-related mycosis care are significantly decreased. This paper explores the affiliation between COVID-19, FNTDs, and AIDS-related mycoses with a predictive perspective.

The impact of Neglected Tropical Diseases (NTDs) on health and wellbeing in sub-Saharan Africa (SSA): A case study of Kenya

The impact of local weather change on uncared for tropical illnesses: a scientific assessment

Neglected tropical illnesses (NTDs) are a various group of illnesses that proceed to have an effect on >1 billion individuals, with these illnesses disproportionately impacting susceptible populations and territories. Climate change is having an growing impact on public health in tropical and subtropical areas and the world over and can have an effect on illness distribution and transmission in doubtlessly various methods. Improving our understanding of how local weather change influences NTDs may help establish populations in danger to incorporate in future public health interventions.

Mouse Adenosine Kinase (ADK) ELISA Kit

DLR-ADK-Mu-48T 48T
EUR 527
  • Should the Mouse Adenosine Kinase (ADK) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Adenosine Kinase (ADK) in samples from tissue homogenates or other biological fluids.

Mouse Adenosine Kinase (ADK) ELISA Kit

DLR-ADK-Mu-96T 96T
EUR 688
  • Should the Mouse Adenosine Kinase (ADK) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Adenosine Kinase (ADK) in samples from tissue homogenates or other biological fluids.

Human Adenosine Kinase (ADK) ELISA Kit

RD-ADK-Hu-48Tests 48 Tests
EUR 521

Human Adenosine Kinase (ADK) ELISA Kit

RD-ADK-Hu-96Tests 96 Tests
EUR 723

Mouse Adenosine Kinase (ADK) ELISA Kit

RD-ADK-Mu-48Tests 48 Tests
EUR 533

Mouse Adenosine Kinase (ADK) ELISA Kit

RD-ADK-Mu-96Tests 96 Tests
EUR 740

Human Adenosine Kinase (ADK) ELISA Kit

RDR-ADK-Hu-48Tests 48 Tests
EUR 544

Human Adenosine Kinase (ADK) ELISA Kit

RDR-ADK-Hu-96Tests 96 Tests
EUR 756

Mouse Adenosine Kinase (ADK) ELISA Kit

RDR-ADK-Mu-48Tests 48 Tests
EUR 557

Mouse Adenosine Kinase (ADK) ELISA Kit

RDR-ADK-Mu-96Tests 96 Tests
EUR 774

ADK antibody

70R-31777 100 ug
EUR 327
Description: Rabbit polyclonal ADK antibody

ADK Antibody

36053-100ul 100ul
EUR 252

ADK antibody

10R-1774 100 ul
EUR 322
Description: Mouse monoclonal ADK antibody

ADK antibody

10R-1782 100 ul
EUR 322
Description: Mouse monoclonal ADK antibody

ADK antibody

10R-10414 100 ug
EUR 435
Description: Mouse monoclonal ADK antibody

ADK antibody

10R-10415 100 ug
EUR 435
Description: Mouse monoclonal ADK antibody

ADK Antibody

DF3218 200ul
EUR 304
Description: ADK Antibody detects endogenous levels of total ADK.

ADK Antibody

1-CSB-PA346232LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADK. Recognizes ADK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

ADK Antibody

1-CSB-PA152141
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADK. Recognizes ADK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

ADK Antibody

1-CSB-PA172054
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADK. Recognizes ADK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

ADK Antibody

1-CSB-PA247810
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ADK. Recognizes ADK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000

ADK Antibody

ABD3218 100 ug
EUR 438

Human ADK Antibody

33145-05111 150 ug
EUR 261

ADK Conjugated Antibody

C36053 100ul
EUR 397

ADK Polyclonal Antibody

ABP53764-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human ADK at AA rangle: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of ADK from Human, Mouse, Rat. This ADK antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human ADK at AA rangle: 1-80

ADK Polyclonal Antibody

ABP53764-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human ADK at AA rangle: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of ADK from Human, Mouse, Rat. This ADK antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human ADK at AA rangle: 1-80

ADK Polyclonal Antibody

ABP53764-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human ADK at AA rangle: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of ADK from Human, Mouse, Rat. This ADK antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human ADK at AA rangle: 1-80

ADK Polyclonal Antibody

ES4763-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ADK from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

ADK Polyclonal Antibody

ES4763-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ADK from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

anti- ADK antibody

FNab00172 100µg
EUR 548.75
  • Immunogen: adenosine kinase
  • Uniprot ID: P55263
  • Gene ID: 132
  • Research Area: Metabolism
Description: Antibody raised against ADK

Anti-ADK antibody

PAab00172 100 ug
EUR 386

Anti-ADK Antibody

PB10031 100ug/vial
EUR 334

Anti-ADK antibody

STJ11100868 100 µl
EUR 413
Description: This gene an enzyme which catalyzes the transfer of the gamma-phosphate from ATP to adenosine, thereby serving as a regulator of concentrations of both extracellular adenosine and intracellular adenine nucleotides. Adenosine has widespread effects on the cardiovascular, nervous, respiratory, and immune systems and inhibitors of the enzyme could play an important pharmacological role in increasing intravascular adenosine concentrations and acting as anti-inflammatory agents. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-ADK antibody

STJ117217 100 µl
EUR 277
Description: This gene an enzyme which catalyzes the transfer of the gamma-phosphate from ATP to adenosine, thereby serving as a regulator of concentrations of both extracellular adenosine and intracellular adenine nucleotides. Adenosine has widespread effects on the cardiovascular, nervous, respiratory, and immune systems and inhibitors of the enzyme could play an important pharmacological role in increasing intravascular adenosine concentrations and acting as anti-inflammatory agents. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-ADK antibody

STJ117218 100 µl
EUR 277
Description: This gene an enzyme which catalyzes the transfer of the gamma-phosphate from ATP to adenosine, thereby serving as a regulator of concentrations of both extracellular adenosine and intracellular adenine nucleotides. Adenosine has widespread effects on the cardiovascular, nervous, respiratory, and immune systems and inhibitors of the enzyme could play an important pharmacological role in increasing intravascular adenosine concentrations and acting as anti-inflammatory agents. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-ADK antibody

STJ91500 200 µl
EUR 197
Description: Rabbit polyclonal to ADK.

Adk/ Rat Adk ELISA Kit

ELI-24395r 96 Tests
EUR 886

ADK siRNA

20-abx900194
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADK siRNA

20-abx906873
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADK siRNA

20-abx906874
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-ADK

YF-PA23185 50 ul
EUR 334
Description: Mouse polyclonal to ADK

ADK Antibody, HRP conjugated

1-CSB-PA346232LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADK. Recognizes ADK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ADK Antibody, FITC conjugated

1-CSB-PA346232LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADK. Recognizes ADK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ADK Antibody, Biotin conjugated

1-CSB-PA346232LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADK. Recognizes ADK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Adenosine Kinase (ADK) Antibody

20-abx007599
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody

abx018200-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody

abx018201-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody

20-abx214242
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody

20-abx214243
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody

20-abx101253
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Adenosine Kinase (ADK) Antibody

20-abx119058
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody

20-abx129762
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Adenosine Kinase (ADK) Antibody

20-abx137257
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody

abx148019-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody

20-abx175249
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Adenosine Kinase (ADK) Antibody

20-abx171082
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Adenosine Kinase (ADK) Antibody

abx033170-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody

abx033170-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody

20-abx338791
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody

20-abx328118
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody

abx230172-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human ADK Antibody (Biotin Conjugate)

33145-05121 150 ug
EUR 369

Polyclonal ADK Antibody (C-term)

APR07051G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADK (C-term). This antibody is tested and proven to work in the following applications:

Adenosine Kinase (ADK) Antibody (HRP)

20-abx334581
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody (FITC)

20-abx334582
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Adenosine Kinase (ADK) Antibody (Biotin)

20-abx334583
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-ADK Antibody (monoclonal, 7F4)

M02193 100ug/vial
EUR 334

ADK Blocking Peptide

DF3218-BP 1mg
EUR 195

ADK Protein (Recombinant)

20-abx073897
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

ADK cloning plasmid

CSB-CL346232HU-10ug 10ug
EUR 401
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1038
  • Sequence: atgacgtcagtcagagaaaatattctctttggaatgggaaatcctctgcttgacatctctgctgtagtggacaaagatttccttgataagtattctctgaaaccaaatgaccaaatcttggctgaagacaaacacaaggaactgtttgatgaacttgtgaaaaaattcaaagtcg
  • Show more
Description: A cloning plasmid for the ADK gene.

ADK Rabbit pAb

A15023-100ul 100 ul
EUR 308

ADK Rabbit pAb

A15023-200ul 200 ul
EUR 459

ADK Rabbit pAb

A15023-20ul 20 ul
EUR 183

ADK Rabbit pAb

A15023-50ul 50 ul
EUR 223

ADK Rabbit pAb

A15024-100ul 100 ul
EUR 308

ADK Rabbit pAb

A15024-200ul 200 ul
EUR 459

ADK Rabbit pAb

A15024-20ul 20 ul
EUR 183

ADK Rabbit pAb

A15024-50ul 50 ul
EUR 223

Anti-ADK (4E7)

YF-MA11836 100 ug
EUR 363
Description: Mouse monoclonal to ADK

Human ADK AssayLite Antibody (FITC Conjugate)

33145-05141 150 ug
EUR 428

Human ADK AssayLite Antibody (RPE Conjugate)

33145-05151 150 ug
EUR 428

Human ADK AssayLite Antibody (APC Conjugate)

33145-05161 150 ug
EUR 428

Human ADK AssayLite Antibody (PerCP Conjugate)

33145-05171 150 ug
EUR 471

Adenosine Kinase (ADK) Polyclonal Antibody (Human)

4-PAC281Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADK (Lys94~Pro339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosine Kinase (ADK)

Adenosine Kinase (ADK) Polyclonal Antibody (Mouse)

4-PAC281Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADK (Met1~His361)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Adenosine Kinase (ADK)

ADK protein (His tag)

80R-1322 50 ug
EUR 305
Description: Purified recombinant Human ADK protein

ADK ELISA KIT|Human

EF007632 96 Tests
EUR 689

Rat ADK shRNA Plasmid

20-abx984966
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ADK shRNA Plasmid

20-abx950091
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ADK shRNA Plasmid

20-abx969053
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Adenosine Kinase (ADK)

4-RPC281Hu01
  • EUR 472.74
  • EUR 229.00
  • EUR 1497.76
  • EUR 565.92
  • EUR 1031.84
  • EUR 379.00
  • EUR 3594.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P55263
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Adenosine Kinase expressed in: E.coli

Recombinant Adenosine Kinase (ADK)

4-RPC281Mu01
  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P55264
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 70.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Adenosine Kinase expressed in: E.coli

ADK Recombinant Protein (Human)

RP000610 100 ug Ask for price

ADK Recombinant Protein (Mouse)

RP114533 100 ug Ask for price

ADK Recombinant Protein (Mouse)

RP114536 100 ug Ask for price

ADK Recombinant Protein (Rat)

RP189356 100 ug Ask for price

Adenosine Kinase (ADK) Polyclonal Antibody (Human), APC

4-PAC281Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADK (Lys94~Pro339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosine Kinase (ADK). This antibody is labeled with APC.

Adenosine Kinase (ADK) Polyclonal Antibody (Human), Biotinylated

4-PAC281Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADK (Lys94~Pro339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosine Kinase (ADK). This antibody is labeled with Biotin.

Articles had been recognized by looking out digital databases for stories of local weather change and NTDs between 1 January 2010 and 1 March 2020. Climate change might affect the emergence and re-emergence of a number of NTDs, significantly people who contain a vector or intermediate host for transmission. Although particular predictions are conflicting relying on the geographic space, the sort of NTD and related vectors and hosts, it’s anticipated that a number of NTDs could have adjustments in their transmission interval and geographic vary and will doubtless encroach on areas and populations which were beforehand unaffected. There is a necessity for improved surveillance and monitoring to establish areas of NTD incursion and emergence and embody these in future public health interventions.